Skip to main content

GWF314
(Plasmid #133610)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 133610 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 133610-D50 50 μg of DNA in Tris buffer $495
DNA 133610-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pJZC43
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CXCR4-6-com, com-GNCR1, BFP
  • gRNA/shRNA sequence
    GCAGACGCGAGGAAGGAGGGCGC

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GWF314 was a gift from Dustin Maly (Addgene plasmid # 133610 ; http://n2t.net/addgene:133610 ; RRID:Addgene_133610)
  • For your References section:

    Multi-input chemical control of protein dimerization for programming graded cellular responses. Foight GW, Wang Z, Wei CT, Jr Greisen P, Warner KM, Cunningham-Bryant D, Park K, Brunette TJ, Sheffler W, Baker D, Maly DJ. Nat Biotechnol. 2019 Sep 9. pii: 10.1038/s41587-019-0242-8. doi: 10.1038/s41587-019-0242-8. 10.1038/s41587-019-0242-8 PubMed 31501561