AAVS1-TRE-SHH
(Plasmid
#134350)
-
PurposeTargeting vector for site specific integration of doxycycline inducible expression of full length human SHH cDNA into human AAVS1 locus
-
Depositing Lab
-
Depositing OrganizationMemorial Sloan-Kettering Cancer Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134350 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 134350-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 134350-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePuro-iDest
- Backbone size w/o insert (bp) 8904
- Total vector size (bp) 8681
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSHH
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1389
-
GenBank IDNM_000193.3
-
Entrez GeneSHH (a.k.a. HHG1, HLP3, HPE3, MCOPCB5, SMMCI, ShhNC, TPT, TPTPS)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GTTTGTACAAAAAAGCAGGC (ATTB1)
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (SV40pA-R)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhuman SHH cDNA was purchased from Genecopoeia, Product ID:T1004
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Puro-iDEST (Addgene #75336)
DNA (Catalog # 134350-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 134350-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-TRE-SHH was a gift from Lorenz Studer (Addgene plasmid # 134350 ; http://n2t.net/addgene:134350 ; RRID:Addgene_134350) -
For your References section:
Specification of positional identity in forebrain organoids. Cederquist GY, Asciolla JJ, Tchieu J, Walsh RM, Cornacchia D, Resh MD, Studer L. Nat Biotechnol. 2019 Apr;37(4):436-444. doi: 10.1038/s41587-019-0085-3. Epub 2019 Apr 1. 10.1038/s41587-019-0085-3 PubMed 30936566