pHCL150
(Plasmid
#134456)
-
PurposeCmR, Para-popZ-rbs-msfGFPC-H3H4. Replicative plasmid for the expression of bait. C-terminal GFP fusion.
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134456 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 134456-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 134456-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepHCL149
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerbs-msfGFPC-H3H4
-
SpeciesSynthetic
- Promoter Para
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GATTATTTGCACGGCGTCACAC
- 3′ sequencing primer gtccattcacatctccgtccag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 134456-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 134456-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHCL150 was a gift from Thomas Bernhardt (Addgene plasmid # 134456 ; http://n2t.net/addgene:134456 ; RRID:Addgene_134456) -
For your References section:
A PopZ-Linked Apical Recruitment Assay for Studying Protein-Protein Interactions in the Bacterial Cell Envelope. Lim HC, Bernhardt TG. Mol Microbiol. 2019 Sep 24. doi: 10.1111/mmi.14391. 10.1111/mmi.14391 PubMed 31550057