pMXs-SOX10
(Plasmid
#134669)
-
PurposeRetroviral expression of human SOX10
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134669 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMXs
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo, the Institute of Medical Science
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSRY-box transcription factor 10
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1400
-
Entrez GeneSOX10 (a.k.a. DOM, PCWH, SOX-10, WS2E, WS4, WS4C)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer caccatggcggaggagcaggaccta
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-SOX10 was a gift from Marius Wernig (Addgene plasmid # 134669 ; http://n2t.net/addgene:134669 ; RRID:Addgene_134669) -
For your References section:
Generation of functional human oligodendrocytes from dermal fibroblasts by direct lineage conversion. Tanabe K, Nobuta H, Yang N, Ang CE, Huie P, Jordan S, Oldham MC, Rowitch DH, Wernig M. Development. 2022 Oct 15;149(20). pii: 275808. doi: 10.1242/dev.199723. Epub 2022 Jun 24. 10.1242/dev.199723 PubMed 35748297