pT-Rex Dest30 dn-cHSF1
(Plasmid
#134736)
-
PurposeMammalian expression vector for inducible expression of a constitutively active dominant-negative HSF1
-
Depositing Lab
-
Depositing OrganizationMassachusetts Institute of Technology
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134736 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 134736-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 134736-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepT-Rex-DEST30
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5951
- Total vector size (bp) 7043
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedn-cHSF1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1092
-
MutationDeletion of amino acids 186-202, 379−529
-
GenBank IDNM_005526.4
-
Entrez GeneHSF1 (a.k.a. HSTF1)
- Promoter CMV/TO
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TGTAAAACGACGGCCAGT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 134736-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 134736-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT-Rex Dest30 dn-cHSF1 was a gift from Matthew D. Shoulders (Addgene plasmid # 134736 ; http://n2t.net/addgene:134736 ; RRID:Addgene_134736) -
For your References section:
Transportable, Chemical Genetic Methodology for the Small Molecule-Mediated Inhibition of Heat Shock Factor 1. Moore CL, Dewal MB, Nekongo EE, Santiago S, Lu NB, Levine SS, Shoulders MD. ACS Chem Biol. 2016 Jan 15;11(1):200-10. doi: 10.1021/acschembio.5b00740. Epub 2015 Nov 19. 10.1021/acschembio.5b00740 PubMed 26502114