-
PurposeComponents for genome editing in mammalian cells with pCAG-All-in-one-hCascade and pBS-U6-crRNA-targeted.
-
Depositing Lab
-
Depositing OrganizationUniversity of Tokyo, Institute of Medical Science (IMS)
Located in Japan -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134920 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 134920-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 134920-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepPB-CAG-EBNXN
-
Backbone manufacturerWellcome Sanger Institute
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas3 with bpNLS
-
SpeciesE. coli
-
Insert Size (bp)2775
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTTCTCCATCTCCAGCCTCGGGGCT
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 134920-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 134920-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB-CAG-hCas3 was a gift from Tomoji Mashimo (Addgene plasmid # 134920 ; http://n2t.net/addgene:134920 ; RRID:Addgene_134920) -
For your References section:
CRISPR-Cas3 induces broad and unidirectional genome editing in human cells. Morisaka H, Yoshimi K, Okuzaki Y, Gee P, Kunihiro Y, Sonpho E, Xu H, Sasakawa N, Naito Y, Nakada S, Yamamoto T, Sano S, Hotta A, Takeda J, Mashimo T. Nat Commun. 2019 Dec 6;10(1):5302. doi: 10.1038/s41467-019-13226-x. 10.1038/s41467-019-13226-x PubMed 31811138