Skip to main content

CAG-AausFP1-Z1
(Plasmid #135047)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135047 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 135047-D50 50 μg of DNA in Tris buffer $495
DNA 135047-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    Z1
  • Backbone manufacturer
    Green lab
  • Backbone size w/o insert (bp) 2284
  • Total vector size (bp) 4005
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AausFP1
  • Alt name
    A. australis fluorescent protein 1
  • Species
    Synthetic
  • Insert Size (bp)
    705
  • Promoter CAG Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer cacgcctaccgcccatttgcg
  • 3′ sequencing primer ggccatttaccgtaagttatgt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CAG-AausFP1-Z1 was a gift from Jordan Green (Addgene plasmid # 135047 ; http://n2t.net/addgene:135047 ; RRID:Addgene_135047)
  • For your References section:

    Engineering of episomal plasmid structure to enhance non-viral Poly(beta-amino ester) nanoparticle gene delivery to liver and brain cancer cells. Yang J, Kollings J, Idnani E, Wilson DR, Cozzone IG, Mendes S, Varanasi M, Tzeng SY, Green JJ. PLoS One. 2026 Jul 23;21(7):e0352468. doi: 10.1371/journal.pone.0352468. eCollection 2026. 10.1371/journal.pone.0352468 PubMed 42490567