pHAGE-FKBP-GFP-NDP52
(Plasmid
#135296)
-
Purposestably express GFP-tagged NDP52 for CID induced mitophagy
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135296 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHAGE
- Backbone size w/o insert (bp) 7778
- Total vector size (bp) 9216
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNDP52
-
Alt nameCALCOCO2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1338
-
GenBank IDNM_001261390.2
-
Entrez GeneCALCOCO2 (a.k.a. NDP52)
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agaagcgcgatcacatgg
- 3′ sequencing primer ATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE-FKBP-GFP-NDP52 was a gift from Richard Youle (Addgene plasmid # 135296 ; http://n2t.net/addgene:135296 ; RRID:Addgene_135296) -
For your References section:
Spatiotemporal Control of ULK1 Activation by NDP52 and TBK1 during Selective Autophagy. Vargas JNS, Wang C, Bunker E, Hao L, Maric D, Schiavo G, Randow F, Youle RJ. Mol Cell. 2019 Apr 18;74(2):347-362.e6. doi: 10.1016/j.molcel.2019.02.010. Epub 2019 Mar 7. 10.1016/j.molcel.2019.02.010 PubMed 30853401