EF1α-mNeonGreen-Z1
(Plasmid
#135613)
-
PurposemNeonGreen monomeric fluorescent protein expression for mammalian cells under EF1a-HTLV promoter in minimal backbone plasmid.
-
Depositing Lab
-
Depositing OrganizationJohns Hopkins University and School of Medicine
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 135613 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneZ1
-
Backbone manufacturerGreen Lab
- Backbone size w/o insert (bp) 2150
- Total vector size (bp) 2861
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemNeonGreen
-
Alt namemonomeric neon green
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter EF1a-HTLV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gttacagatccaagctgtgacc
- 3′ sequencing primer GATGAGTTTGGACAAACCAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EF1α-mNeonGreen-Z1 was a gift from Jordan Green (Addgene plasmid # 135613 ; http://n2t.net/addgene:135613 ; RRID:Addgene_135613) -
For your References section:
Engineering of episomal plasmid structure to enhance non-viral Poly(beta-amino ester) nanoparticle gene delivery to liver and brain cancer cells. Yang J, Kollings J, Idnani E, Wilson DR, Cozzone IG, Mendes S, Varanasi M, Tzeng SY, Green JJ. PLoS One. 2026 Jul 23;21(7):e0352468. doi: 10.1371/journal.pone.0352468. eCollection 2026. 10.1371/journal.pone.0352468 PubMed 42490567