Skip to main content

U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_LMD9_2xUGI_3xHA
(Plasmid #136652)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136652 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 136652-D50 50 μg of DNA in Tris buffer $495
DNA 136652-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    MSP1594_2x_NLS (Plasmid #110625)
  • Total vector size (bp) 8715
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    St1Cas9 LMD-9
  • Species
    H. sapiens (human), Synthetic
  • Promoter CAG
  • Tags / Fusion Proteins
    • SV40 NLS (N terminal on insert)
    • SV40 NLS (C terminal on insert)
    • APOBEC-1 (N terminal on insert)
    • 2xUGI (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgtgggccacaggcctgaag
  • 3′ sequencing primer AGCCCTGCTGAAGTCCAACTTGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    sgRNA for St1Cas9
  • Species
    H. sapiens (human), Synthetic
  • Promoter U6

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    APOBEC-1
  • Species
    H. sapiens (human)
  • Entrez Gene
    APOBEC1 (a.k.a. APO1, APOBEC-1, BEDP, CDAR1, HEPR)
  • Promoter CAG
  • Tag / Fusion Protein
    • hSt1Cas9 (C terminal on insert)

Cloning Information for Gene/Insert 3

Gene/Insert 4

  • Gene/Insert name
    UGI
  • Species
    H. sapiens (human), Synthetic
  • Promoter CAG
  • Tag / Fusion Protein
    • hSt1Cas9 (N terminal on insert)

Cloning Information for Gene/Insert 4

Gene/Insert 5

  • Gene/Insert name
    HA tag
  • Species
    Synthetic
  • Tag / Fusion Protein
    • UGI (N terminal on insert)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_LMD9_2xUGI_3xHA was a gift from Yannick Doyon (Addgene plasmid # 136652 ; http://n2t.net/addgene:136652 ; RRID:Addgene_136652)
  • For your References section:

    Versatile and robust genome editing with Streptococcus thermophilus CRISPR1-Cas9. Agudelo D, Carter S, Velimirovic M, Duringer A, Rivest JF, Levesque S, Loehr J, Mouchiroud M, Cyr D, Waters PJ, Laplante M, Moineau S, Goulet A, Doyon Y. Genome Res. 2020 Jan;30(1):107-117. doi: 10.1101/gr.255414.119. Epub 2020 Jan 3. 10.1101/gr.255414.119 PubMed 31900288