Skip to main content

Flag-2xAPEX2-C Cloning Vector
(Plasmid #136991)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136991 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCD-betaG-FLAG
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    APEX2
  • Tag / Fusion Protein
    • Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer GCGTGCCTAATGGGAGGTCT (CSF)
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATC (pCD-betaG-FLAG-R)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This vector contains 2 copies of the APEX2 gene for increased activity.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Flag-2xAPEX2-C Cloning Vector was a gift from Ken-Ichi Takemaru (Addgene plasmid # 136991 ; http://n2t.net/addgene:136991 ; RRID:Addgene_136991)