Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #70224)


Item Catalog # Description Quantity Price (USD)
Plasmid 70224 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    pHRdSV40-NLS-dCas9-24xGCN4_v4-NLS-P2A-BFP-dWPRE (addgene #60910)
  • Backbone size w/o insert (bp) 8500
  • Total vector size (bp) 14000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
  • Insert Size (bp)
  • Tag / Fusion Protein
    • GFP11x7 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCATGCATCTCAATTAGTC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Depositor Comments

There is a stop codon found between 7xGFP11 and BFP. BFP expression is not necessary for the imaging system described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHRm-NLS-dCas9-GFP11x7-NLS was a gift from Bo Huang (Addgene plasmid # 70224 ; ; RRID:Addgene_70224)
  • For your References section:

    Versatile protein tagging in cells with split fluorescent protein. Kamiyama D, Sekine S, Barsi-Rhyne B, Hu J, Chen B, Gilbert LA, Ishikawa H, Leonetti MD, Marshall WF, Weissman JS, Huang B. Nat Commun. 2016 Mar 18;7:11046. doi: 10.1038/ncomms11046. 10.1038/ncomms11046 PubMed 26988139