Skip to main content

pAIO-LbCpf1
(Plasmid #137847)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137847 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 137847-D50 50 μg of DNA in Tris buffer $495
DNA 137847-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pAIO3
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LbCpf1-NLS-FLAG
  • Alt name
    Cpf1
  • Species
    Lachnospiraceae bacterium ND2006
  • Insert Size (bp)
    3765

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTAGAAAAGGAATAACTAATATTTTATTTATTATCATTCAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Zetsche et al, Addgene #69988

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAIO-LbCpf1 was a gift from Josh Beck (Addgene plasmid # 137847 ; http://n2t.net/addgene:137847 ; RRID:Addgene_137847)
  • For your References section:

    EXP1 is required for organisation of EXP2 in the intraerythrocytic malaria parasite vacuole. Nessel T, Beck JM, Rayatpisheh S, Jami-Alahmadi Y, Wohlschlegel JA, Goldberg DE, Beck JR. Cell Microbiol. 2020 Jan 28:e13168. doi: 10.1111/cmi.13168. 10.1111/cmi.13168 PubMed 31990132