Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAIO-LbCpf1
(Plasmid #137847)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 137847 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LbCpf1-NLS-FLAG
  • Alt name
    Cpf1
  • Species
    Lachnospiraceae bacterium ND2006
  • Insert Size (bp)
    3765

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTAGAAAAGGAATAACTAATATTTTATTTATTATCATTCAAG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAIO-LbCpf1 was a gift from Josh Beck (Addgene plasmid # 137847 ; http://n2t.net/addgene:137847 ; RRID:Addgene_137847)
  • For your References section:

    EXP1 is required for organisation of EXP2 in the intraerythrocytic malaria parasite vacuole. Nessel T, Beck JM, Rayatpisheh S, Jami-Alahmadi Y, Wohlschlegel JA, Goldberg DE, Beck JR. Cell Microbiol. 2020 Jan 28:e13168. doi: 10.1111/cmi.13168. 10.1111/cmi.13168 PubMed 31990132