pSB1C3-hsg(M)
(Plasmid
#138262)
-
PurposeSubcloning and expression of mCherry-targeting sgRNA M for use in Traffic Light reporter system
-
Depositing Lab
-
Depositing OrganizationArizona State University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138262 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 138262-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 138262-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSB1C3
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA M
-
gRNA/shRNA sequenceGTTGCTCACCATGGTGGCGAC
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 138262-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 138262-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB1C3-hsg(M) was a gift from Xiao Wang (Addgene plasmid # 138262 ; http://n2t.net/addgene:138262 ; RRID:Addgene_138262) -
For your References section:
RNA-Guided Recombinase-Cas9 Fusion Targets Genomic DNA Deletion and Integration. Standage-Beier K, Brookhouser N, Balachandran P, Zhang Q, Brafman DA, Wang X. CRISPR J. 2019 Aug;2:209-222. doi: 10.1089/crispr.2019.0013. 10.1089/crispr.2019.0013 PubMed 31436506