pBV-luc TOP2A 1kb promoter
(Plasmid
#138274)
-
PurposeLuciferase reporter plasmid driven by TOP2A promoter
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 138274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 138274-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 138274-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBV-luc
-
Backbone manufacturerBert Vogelstein (Addgene plasmid #16539)
- Backbone size w/o insert (bp) 4867
- Total vector size (bp) 5839
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTOP2A promoter sequence
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1000
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctagcaaaataggctgtccc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 138274-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 138274-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBV-luc TOP2A 1kb promoter was a gift from Wen Xue (Addgene plasmid # 138274 ; http://n2t.net/addgene:138274 ; RRID:Addgene_138274) -
For your References section:
Depletion of TRRAP induces p53-independent senescence in liver cancer by downregulating mitotic genes. Kwan SY, Sheel A, Song CQ, Zhang XO, Jiang T, Dang H, Cao Y, Ozata DM, Mou H, Yin H, Weng Z, Wang XW, Xue W. Hepatology. 2019 Jun 12. doi: 10.1002/hep.30807. 10.1002/hep.30807 PubMed 31188495
Map uploaded by the depositor.
