Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGL4.18 NR0B1-Luc
(Plasmid #100983)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 100983 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL4.18
  • Backbone manufacturer
    Promega
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NR0B1
  • Species
    H. sapiens (human)
  • Entrez Gene
    NR0B1 (a.k.a. AHC, AHCH, AHX, DAX-1, DAX1, DSS, GTD, HHG, NROB1, SRXY2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site NheI (unknown if destroyed)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer GACGATAGTCATGCCCCGCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.18 NR0B1-Luc was a gift from Lee Helman (Addgene plasmid # 100983 ; http://n2t.net/addgene:100983 ; RRID:Addgene_100983)
  • For your References section:

    Identification of an inhibitor of the EWS-FLI1 oncogenic transcription factor by high-throughput screening. Grohar PJ, Woldemichael GM, Griffin LB, Mendoza A, Chen QR, Yeung C, Currier DG, Davis S, Khanna C, Khan J, McMahon JB, Helman LJ. J Natl Cancer Inst. 2011 Jun 22;103(12):962-78. doi: 10.1093/jnci/djr156. Epub 2011 Jun 8. 10.1093/jnci/djr156 PubMed 21653923