Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDH-puro-EWS-FLI1
(Plasmid #102813)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102813 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDH-puro
  • Backbone size w/o insert (bp) 7384
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EWS-FLI1
  • Species
    H. sapiens (human)
  • Entrez Gene
    EWSR1 (a.k.a. EWS, EWS-FLI1, bK984G1.4)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe 1 (unknown if destroyed)
  • 3′ cloning site Not 1 (unknown if destroyed)
  • 5′ sequencing primer CMV-F CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The cDNA sequence of EWS-FLI1 was subcloned into the NheI and NotI sites of the lentiviral vector pCDH-CMV-MCS-EF1-Puro.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-puro-EWS-FLI1 was a gift from Jialiang Wang (Addgene plasmid # 102813 ; http://n2t.net/addgene:102813 ; RRID:Addgene_102813)
  • For your References section:

    BET bromodomain inhibitors suppress EWS-FLI1-dependent transcription and the IGF1 autocrine mechanism in Ewing sarcoma. Loganathan SN, Tang N, Fleming JT, Ma Y, Guo Y, Borinstein SC, Chiang C, Wang J. Oncotarget. 2016 Jul 12;7(28):43504-43517. doi: 10.18632/oncotarget.9762. 10.18632/oncotarget.9762 PubMed 27259270