pMSCV-NLS-CBRed-d2-hygro
(Plasmid #139196)

• Purpose: non-ERK dependent control plasmid for pMSCV-NLS-CBGreen-FIRE-puro
• Depositing Lab: Matthew Lazzara
• Publication: Day et al Cell Rep. 2020 Mar 10;30(10):3383-3396.e7. doi: 10.1016/j.celrep.2020.02.014.

Backbone

• Vector backbone: pMSCV-hygro
• Backbone size w/o insert (bp): 6586
• Total vector size (bp): 8394
• Vector type: Mammalian Expression, Retroviral, Luciferase
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: CBRed
• Alt name: Click beetle red luciferase
• Species: Synthetic; Pyrophosphorus plagiophthalamus
• Insert Size (bp): 1764
• Tags / Fusion Proteins:
  • nuclear localization signal (NLS) (N terminal on insert)
  • d2 PEST domain (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC

Resource Information

• Supplemental Documents:
  • pMSCV-NLS-CBRed-d2-hygro.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry