Skip to main content

pMSCV-NLS-CBGreen-FIRE-puro
(Plasmid #139195)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 139195 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pMSCV-puro
  • Backbone size w/o insert (bp) 6261
  • Total vector size (bp) 8278
  • Vector type
    Mammalian Expression, Retroviral, Luciferase
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CBG99
  • Alt name
    Click beetle green luciferase
  • Species
    Synthetic; Pyrophosphorus plagiophthalamus
  • Mutation
    See depositor comments below
  • Tags / Fusion Proteins
    • nuclear localization signal (NLS) (N terminal on insert)
    • Fra1 PEST domain fragment (FIRE) (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: This plasmid contains a G255V mutation in CBG99. This mutation is not expected to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-NLS-CBGreen-FIRE-puro was a gift from Matthew Lazzara (Addgene plasmid # 139195 ; http://n2t.net/addgene:139195 ; RRID:Addgene_139195)
  • For your References section:

    Glioblastoma Cell Resistance to EGFR and MET Inhibition Can Be Overcome via Blockade of FGFR-SPRY2 Bypass Signaling. Day EK, Sosale NG, Xiao A, Zhong Q, Purow B, Lazzara MJ. Cell Rep. 2020 Mar 10;30(10):3383-3396.e7. doi: 10.1016/j.celrep.2020.02.014. 10.1016/j.celrep.2020.02.014 PubMed 32160544