pCEFL EGFP-TEADi
(Plasmid #140144)

• Purpose: TEAD inhibitor (TEADi): GFP-tagged inhibitor of the interaction of YAP1 and TAZ with TEAD transcription factors with nuclear localization signal.
• Depositing Lab: Ramiro Iglesias-Bartolome
• Depositing Organization: National Cancer Institute (NCI)
  Located in United States of America
• Publication: Yuan et al Nat Commun. 2020 Mar 19;11(1):1472. doi: 10.1038/s41467-020-15301-0.
• Citations: 1 Article

Backbone

• Vector backbone: pCEFL
• Total vector size (bp): 6803
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP TEADi
• Alt name: Green fluorescent tagged TEAD inhibitor
• Species: H. sapiens (human)
• Insert Size (bp): 1077
• Promoter: EF1a
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TTCTTCCATTTCAGGTGTCG
• 3′ sequencing primer: ATT TAG GTG ACA CTA TAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We have observed that in certain cancer cell lines TEADi gets degraded or is expressed at low levels, resulting in incomplete TEAD inhibition. We recommend checking by Western Blot with anti-GFP antibody that the correct molecular weight of the full construct is expressed (approximately 39kDa) and check that known targets of TEAD are downregulated upon expression of TEADi. As with other dominant negative proteins, good levels of expression are necessary for TEADi to block TEADs.

DNA (Catalog # 140144-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 140144-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.