pCRI005-pYFAC-riboB-PgpdA-dLbCpf1(D156R)-VPR-TtrpC
(Plasmid
#140198)
-
PurposeEpisomal expression of dLbCpf1(D156R)-VPR, variant for culture at room temperature. Filamentous fungi vector with AMA1 and riboB selection marker.
-
Depositing Lab
-
Depositing OrganizationUniversity of Western Australia
Located in Australia -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 140198 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 140198-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 140198-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepYFAC-riboB
-
Backbone manufacturerDOI: 10.1039/C8SC02870B
- Backbone size w/o insert (bp) 14777
- Total vector size (bp) 25045
-
Modifications to backboneWe added Leu Kan markers for more stringent selection during cloning.
-
Vector typeCRISPR, Synthetic Biology ; Expression in Aspergillus nidulans and related filamentous fungi.
-
Selectable markersLEU2, URA3 ; Af riboB
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedLbCas12a(D156R)-VPR
-
Alt namedCpf1(D156R)-VPR
-
SpeciesSynthetic; Lachnospiraceae bacterium
-
Insert Size (bp)5349
-
MutationD832A DNase deactivated, D156R for improved activity at 25 °C
- Promoter PgpdA
-
Tag
/ Fusion Protein
- VPR (VP64-p65-Rta), NLS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACTGAGAACCATGGCACCGAAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 140198-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 140198-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRI005-pYFAC-riboB-PgpdA-dLbCpf1(D156R)-VPR-TtrpC was a gift from Yit Heng Chooi (Addgene plasmid # 140198 ; http://n2t.net/addgene:140198 ; RRID:Addgene_140198) -
For your References section:
CRISPR-mediated activation of biosynthetic gene clusters for bioactive molecule discovery in filamentous fungi. Roux I, Woodcraft C, Hu J, Wolters R, Gilchrist CLM, Chooi YH. ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197. 10.1021/acssynbio.0c00197 PubMed 32526136