pCRI009-pKW20088-PelcA-mCherry-TtrpC-NotI-PacI
(Plasmid
#140202)
-
PurposeCRISPRa proof-of-concept test target with fluorescent reporter. PelcA is fused to mCherry, with low basal expression in Aspergillus nidulans. Fungal vector with AMA1 and pyrG selection marker.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140202 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepKW20088
-
Backbone manufacturerdoi:10.1038/nchembio.1366
- Backbone size w/o insert (bp) 14245
- Total vector size (bp) 15879
-
Vector typeCRISPR, Synthetic Biology ; Proof-of-concept test target of a in filamentous fungi.
-
Selectable markersURA3 ; Af pyrG
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry
-
Insert Size (bp)709
-
MutationG174D
- Promoter PelcA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CACTGAGAACCATGGCACCGAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The PelcA-mCherry has no observable basal expression in Aspergillus nidulans, constituting a good test target for CRISPRa. Also contains PacI NotI sites to clone other components, and allows cloning in Saccharomyces cerevisiae. The mCherry mutation G174D does not appear to affect fluorescence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRI009-pKW20088-PelcA-mCherry-TtrpC-NotI-PacI was a gift from Yit Heng Chooi (Addgene plasmid # 140202 ; http://n2t.net/addgene:140202 ; RRID:Addgene_140202) -
For your References section:
CRISPR-mediated activation of biosynthetic gene clusters for bioactive molecule discovery in filamentous fungi. Roux I, Woodcraft C, Hu J, Wolters R, Gilchrist CLM, Chooi YH. ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197. 10.1021/acssynbio.0c00197 PubMed 32526136