pCRI009-pKW20088-PelcA-mCherry-TtrpC-NotI-PacI
(Plasmid #140202)

• Purpose: CRISPRa proof-of-concept test target with fluorescent reporter. PelcA is fused to mCherry, with low basal expression in Aspergillus nidulans. Fungal vector with AMA1 and pyrG selection marker.
• Depositing Lab: Yit Heng Chooi
• Publication: Roux et al ACS Synth Biol. 2020 Jun 11. doi: 10.1021/acssynbio.0c00197.

Backbone

• Vector backbone: pKW20088
• Backbone manufacturer: doi:10.1038/nchembio.1366
• Backbone size w/o insert (bp): 14245
• Total vector size (bp): 15879
• Vector type: CRISPR, Synthetic Biology ; Proof-of-concept test target of a in filamentous fungi.
• Selectable markers: URA3 ; Af pyrG

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mCherry
• Insert Size (bp): 709
• Mutation: G174D
• Promoter: PelcA

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CACTGAGAACCATGGCACCGAAG

Resource Information

• Supplemental Documents:
  • Annotated Depositor's Sequence

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The PelcA-mCherry has no observable basal expression in Aspergillus nidulans, constituting a good test target for CRISPRa. Also contains PacI NotI sites to clone other components, and allows cloning in Saccharomyces cerevisiae. The mCherry mutation G174D does not appear to affect fluorescence.