Skip to main content

pPB-CAG-ECC-Biosensor
(Plasmid #140832)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 140832 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 140832-D50 50 μg of DNA in Tris buffer $495
DNA 140832-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pPB
  • Total vector size (bp) 10437
  • Vector type
    Mammalian Expression ; PiggyBac (PB) transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ECC-Biosensor
  • Species
    Synthetic
  • Insert Size (bp)
    2995

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer TGTCTCATCATTTTGGCAAAGAA
  • 3′ sequencing primer AGCCTCTGCAGCTAGAATCAGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that differences between the Addgene verified sequence and depositor reference sequence should not affect plasmid function.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPB-CAG-ECC-Biosensor was a gift from Yonglun Luo (Addgene plasmid # 140832 ; http://n2t.net/addgene:140832 ; RRID:Addgene_140832)
  • For your References section:

    CRISPR-C: circularization of genes and chromosome by CRISPR in human cells. Moller HD, Lin L, Xiang X, Petersen TS, Huang J, Yang L, Kjeldsen E, Jensen UB, Zhang X, Liu X, Xu X, Wang J, Yang H, Church GM, Bolund L, Regenberg B, Luo Y. Nucleic Acids Res. 2018 Dec 14;46(22):e131. doi: 10.1093/nar/gky767. 10.1093/nar/gky767 PubMed 30551175