pPB-TRE-ECC-Biosensor
(Plasmid #140833)

• Purpose: Encoding the TRE promoter based eccDNA biosensor
• Depositing Lab: Yonglun Luo
• Publication: Moller et al Nucleic Acids Res. 2018 Dec 14;46(22):e131. doi: 10.1093/nar/gky767.

Backbone

• Vector backbone: pPB
• Backbone size w/o insert (bp): 6825
• Total vector size (bp): 10198
• Modifications to backbone: no
• Vector type: Mammalian Expression ; PiggyBac (PB) transposon
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TRE-ECC Biosensor
• Species: Synthetic
• Insert Size (bp): 3373
• Promoter: inverse

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: CTTCCTACCCTCGTAAAGGTC
• 3′ sequencing primer: TCGCAGATCCACTTAGATTCAG

Resource Information

• Supplemental Documents:
  • PB-TRE-ECC-EF1a.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the Addgene verified sequence differs from the depositor's reference sequence but does not affect plasmid function.