pIS54 ADAR 3'UTR mut
(Plasmid
#14488)
-
Depositing Lab
-
Depositing OrganizationWhitehead Institute for Biomedical Research
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 14488 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 14488-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 14488-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepIS1
-
Backbone manufacturerBartel Lab
- Backbone size w/o insert (bp) 4085
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameADAR 3'UTR mutant
-
Alt nameADAR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)290
-
MutationCATTCC’s were changed to AAGTAC's
-
Entrez GeneADAR (a.k.a. ADAR1, AGS6, DRADA, DSH, DSRAD, G1P1, IFI-4, IFI4, K88DSRBP, P136)
-
Tag
/ Fusion Protein
- luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer n/a
- 3′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ADAR 3'UTR mutant in renilla luciferase reporter plasmid.
DNA (Catalog # 14488-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 14488-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIS54 ADAR 3'UTR mut was a gift from David Bartel (Addgene plasmid # 14488 ; http://n2t.net/addgene:14488 ; RRID:Addgene_14488) -
For your References section:
Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS, Johnson JM. Nature. 2005 Feb 17. 433(7027):769-73. 10.1038/nature03315 PubMed 15685193