Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCXN2-BCL6 (CXN-BCL6)
(Plasmid #40346)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 40346 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCXN2
  • Backbone manufacturer
    Niwa, Yamamura, and Miyazaki (PMID: 1660837)
  • Backbone size w/o insert (bp) 5200
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BCL6
  • Alt name
    BCL-6
  • Alt name
    B-cell CLL/lymphoma 6
  • Species
    H. sapiens (human)
  • Entrez Gene
    BCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
  • Promoter pCAG
  • Tag / Fusion Protein
    • FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI/SalI (destroyed during cloning)
  • 3′ cloning site SalI/XhoI (destroyed during cloning)
  • 5′ sequencing primer pCAG-F
  • 3′ sequencing primer Bglob-pA-R (ttttggcagagggaaaaaga)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CXN-BCL-6 was constructed by inserting the human BCL-6 cDNA from pBS-BCL-6 full length (FL) via SalI ends into the XhoI site in the pCXN2 expression vector. The pCXN2 (CXN) vector was obtained from Dr. K. Ozato (National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD) and consists of the human BCL-6 cDNA driven by a hybrid β-actin-CMV promoter.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCXN2-BCL6 (CXN-BCL6) was a gift from Alexander Dent (Addgene plasmid # 40346 ; http://n2t.net/addgene:40346 ; RRID:Addgene_40346)
  • For your References section:

    Repression of AP-1 function: a mechanism for the regulation of Blimp-1 expression and B lymphocyte differentiation by the B cell lymphoma-6 protooncogene. Vasanwala FH, Kusam S, Toney LM, Dent AL. J Immunol. 2002 Aug 15;169(4):1922-9. PubMed 12165517