-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCXN2
-
Backbone manufacturerNiwa, Yamamura, and Miyazaki (PMID: 1660837)
- Backbone size w/o insert (bp) 5200
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBCL6
-
Alt nameBCL-6
-
Alt nameB-cell CLL/lymphoma 6
-
SpeciesH. sapiens (human)
-
Entrez GeneBCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
- Promoter pCAG
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI/SalI (destroyed during cloning)
- 3′ cloning site SalI/XhoI (destroyed during cloning)
- 5′ sequencing primer pCAG-F
- 3′ sequencing primer Bglob-pA-R (ttttggcagagggaaaaaga) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CXN-BCL-6 was constructed by inserting the human BCL-6 cDNA from pBS-BCL-6 full length (FL) via SalI ends into the XhoI site in the pCXN2 expression vector. The pCXN2 (CXN) vector was obtained from Dr. K. Ozato (National Institute of Child Health and Human Development, National Institutes of Health, Bethesda, MD) and consists of the human BCL-6 cDNA driven by a hybrid β-actin-CMV promoter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCXN2-BCL6 (CXN-BCL6) was a gift from Alexander Dent (Addgene plasmid # 40346 ; http://n2t.net/addgene:40346 ; RRID:Addgene_40346) -
For your References section:
Repression of AP-1 function: a mechanism for the regulation of Blimp-1 expression and B lymphocyte differentiation by the B cell lymphoma-6 protooncogene. Vasanwala FH, Kusam S, Toney LM, Dent AL. J Immunol. 2002 Aug 15;169(4):1922-9. PubMed 12165517