CXN-BCL-6 ZFΔ (pCXN2-BCL6-ZFdel)
(Plasmid
#40347)
-
Depositing Lab
-
Depositing OrganizationIndiana University School of Medicine, Indianapolis
Located in the United States of America -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 40347 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 40347-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 40347-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCXN2
-
Backbone manufacturerNiwa, Yamamura, and Miyazaki (PMID: 1660837)
- Backbone size w/o insert (bp) 5200
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBCL-6 ZFΔ
-
Alt nameBCL-6
-
SpeciesH. sapiens (human)
-
MutationContains aa1-504; ZF domain deleted (see note below)
-
Entrez GeneBCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
- Promoter pCAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer pCAG-F
- 3′ sequencing primer Bglob-pA-R (ttttggcagagggaaaaaga)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The CXN-BCL-6 ZF deletion was made by digesting pBS-BCL-6FL with AspI, which cleaves a unique site in the human BCL-6 cDNA 45 bp before the start of the ZF domain, and HindIII, which cleaves the pBS vector. The digested plasmid was separated from the smaller deleted fragment, and ligated. The truncated cDNA was then cloned into pCXN2 via SalI and XhoI.
DNA (Catalog # 40347-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 40347-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CXN-BCL-6 ZFΔ (pCXN2-BCL6-ZFdel) was a gift from Alexander Dent (Addgene plasmid # 40347 ; http://n2t.net/addgene:40347 ; RRID:Addgene_40347) -
For your References section:
Repression of AP-1 function: a mechanism for the regulation of Blimp-1 expression and B lymphocyte differentiation by the B cell lymphoma-6 protooncogene. Vasanwala FH, Kusam S, Toney LM, Dent AL. J Immunol. 2002 Aug 15;169(4):1922-9. PubMed 12165517