Skip to main content

pBSV2H_Psyn-sgRNAflaB
(Plasmid #149561)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 149561 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pBSV2H
  • Backbone manufacturer
    CJW lab
  • Vector type
    Bacterial Expression, CRISPR
  • Selectable markers
    Rifampicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNAflaB
  • gRNA/shRNA sequence
    AAAATTTAAATTTCTGACTT
  • Species
    Synthetic
  • Promoter Psyn

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer Unknown
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene QC identified an IS element present in the backbone sequence. The depositing lab does not believe this impacts the functional use of the plasmid but requesting scientists should validate expected behavior prior to experimentation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBSV2H_Psyn-sgRNAflaB was a gift from Christine Jacobs-Wagner (Addgene plasmid # 149561 ; http://n2t.net/addgene:149561 ; RRID:Addgene_149561)
  • For your References section:

    A CRISPR interference platform for selective downregulation of gene expression in Borrelia burgdorferi. Takacs CN, Scott M, Chang Y, Kloos ZA, Irnov I, Rosa PA, Liu J, Jacobs-Wagner C. Appl Environ Microbiol. 2020 Nov 30. pii: AEM.02519-20. doi: 10.1128/AEM.02519-20. 10.1128/AEM.02519-20 PubMed 33257311