pLenti-EF1α-IRES-EGFP-hMCIDAS
(Plasmid
#149696)
-
PurposeExpresses untagged human MCIDAS in mammalian cells
-
Depositing Lab
-
Depositing OrganizationStony Brook University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 149696 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEF1α-IRES-EGFP
- Backbone size w/o insert (bp) 10500
- Total vector size (bp) 11700
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMCIDAS
-
Alt nameIDAS
-
Alt nameMULTICILIN
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1200
-
Entrez GeneMCIDAS (a.k.a. CILD42, IDAS, MCI, MCIN)
- Promoter EF1 alpha
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer TTCTCAAGCCTCAGACAGTG
- 3′ sequencing primer AAGCGGCTTCGGCCAGTAAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-EF1α-IRES-EGFP-hMCIDAS was a gift from Ken-Ichi Takemaru (Addgene plasmid # 149696 ; http://n2t.net/addgene:149696 ; RRID:Addgene_149696)