Skip to main content
Addgene
Open Menu

PB-CAG-mRuby3-Gal8-P2A-Zeo
(Plasmid #150815)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 150815 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 150815-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 150815-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    PB-CAG-GAPd2
  • Backbone size w/o insert (bp) 6466
  • Total vector size (bp) 7864
  • Modifications to backbone
    In-frame insertion of Gal8 to form c-terminus fusion protein with mRuby3 with P2A ribosomal skip site followed by zeocin resistance for mammalian selection
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mRuby3-Gal8-P2A-Zeo
  • Alt name
    Galectin-8
  • Alt name
    mRuby3
  • Alt name
    LGALS8
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2241
  • GenBank ID
    3964
  • Entrez Gene
    LGALS8 (a.k.a. Gal-8, PCTA-1, PCTA1, Po66-CBP)
  • Promoter CAG
  • Tag / Fusion Protein
    • Gal8 is fused to the c-terminus of mRuby3 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer GCAACATATGCCCATATGCTGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-CAG-mRuby3-Gal8-P2A-Zeo was a gift from Jordan Green (Addgene plasmid # 150815 ; http://n2t.net/addgene:150815 ; RRID:Addgene_150815)

  • For your References section:

    High-throughput and high-content bioassay enables tuning of polyester nanoparticles for cellular uptake, endosomal escape, and systemic in vivo delivery of mRNA. Rui Y, Wilson DR, Tzeng SY, Yamagata HM, Sudhakar D, Conge M, Berlinicke CA, Zack DJ, Tuesca A, Green JJ. Sci Adv. 2022 Jan 7;8(1):eabk2855. doi: 10.1126/sciadv.abk2855. 10.1126/sciadv.abk2855 PubMed 34985952
Related items:
Commonly requested with: