PB-GFP-Gal8
(Plasmid #127191)

• Purpose: Piggybac transposon plasmid with CAG promoter GFP-Galectin 8 (GFP-Gal8) fusion protein. Useful as genetically encoded endosomal escape sensor.
• Depositing Lab: Jordan Green
• Publication: Rui et al Sci Adv. 2019 Dec 6;5(12):eaay3255. doi: 10.1126/sciadv.aay3255. eCollection 2019 Dec.

Backbone

• Vector backbone: PB-CAG-GAPd2
• Backbone size w/o insert (bp): 6466
• Total vector size (bp): 7422
• Modifications to backbone: In-frame insertion of Gal8 to form c-terminus fusion protein with GFP
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP-Gal8
• Alt name: Galectin-8
• Alt name: GFP
• Alt name: LGALS8
• Species: H. sapiens (human)
• Insert Size (bp): 2135
• GenBank ID: 3964
• Entrez Gene: LGALS8 (a.k.a. Gal-8, PCTA-1, PCTA1, Po66-CBP)
• Promoter: CMV
• Tag / Fusion Protein:
  • Gal8 is fused to the c-terminus of GFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsrGI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: AAGATCTCAGTGGTATTTGTGAG

Resource Information

• Supplemental Documents:
  • pb-gfp-gal8.gb
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry