Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

PB-CAG-mRuby3-Gal8-P2A-Zeo
(Plasmid #150815)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 150815 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PB-CAG-GAPd2
  • Backbone size w/o insert (bp) 6466
  • Total vector size (bp) 7864
  • Modifications to backbone
    In-frame insertion of Gal8 to form c-terminus fusion protein with mRuby3 with P2A ribosomal skip site followed by zeocin resistance for mammalian selection
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mRuby3-Gal8-P2A-Zeo
  • Alt name
    Galectin-8
  • Alt name
    mRuby3
  • Alt name
    LGALS8
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2241
  • GenBank ID
    3964
  • Entrez Gene
    LGALS8 (a.k.a. Gal-8, PCTA-1, PCTA1, Po66-CBP)
  • Promoter CAG
  • Tag / Fusion Protein
    • Gal8 is fused to the c-terminus of mRuby3 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer GCAACATATGCCCATATGCTGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-CAG-mRuby3-Gal8-P2A-Zeo was a gift from Jordan Green (Addgene plasmid # 150815 ; http://n2t.net/addgene:150815 ; RRID:Addgene_150815)