-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in the United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 15285 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 15285-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 15285-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSH1
-
Backbone manufacturerGR Crabtree lab
- Backbone size w/o insert (bp) 3500
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFGFR1 kinase, FKBP12v36
-
Alt nameflg
-
Alt namebFGFR
-
Alt nameCek-1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2020
-
MutationFGFR1 cytoplasmic domain FKBP12 F36V
-
Entrez GeneFgfr1 (a.k.a. Eask, FGFR-I, FLG, Fgfr-1, Flt-2, Fr1, Hspy, MFR, bFGF-R-1, c-fgr)
-
Tags
/ Fusion Proteins
- HA epitope (C terminal on insert)
- Myristoylation-targeting domain c-Src (14aa) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI, SacII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gaggtgttacttctgctctaaaagc
- 3′ sequencing primer cactgcattctagttgtggtttg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 15285-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 15285-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSH1/M-FGFR1-Fv-Fvls-E was a gift from David Spencer (Addgene plasmid # 15285 ; http://n2t.net/addgene:15285 ; RRID:Addgene_15285) -
For your References section:
Conditional activation of fibroblast growth factor receptor (FGFR) 1, but not FGFR2, in prostate cancer cells leads to increased osteopontin induction, extracellular signal-regulated kinase activation, and in vivo proliferation. Freeman KW, Gangula RD, Welm BE, Ozen M, Foster BA, Rosen JM, Ittmann M, Greenberg NM, Spencer DM. Cancer Res. 2003 Oct 1. 63(19):6237-43. PubMed 14559809
Map uploaded by the depositor.
