Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMSCV-F-del Casp9.IRES.GFP
(Plasmid #15567)


Item Catalog # Description Quantity Price (USD)
Plasmid 15567 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5300
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    FKBP12 F36 to V Truncated Caspase9 (135-416; lacking pro-domain)
  • GenBank ID
    AH002818 NM_001229
  • Entrez Gene
    FKBP1A (a.k.a. FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE)
  • Tags / Fusion Proteins
    • HA epitope (C terminal on insert)
    • FKBP12 (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer cccttgaacctcctcgttcgac
  • 3′ sequencing primer cgctttaaatttgcgcatgctagc
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Based on L. Fan et al (99) Human Gene Therapy

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-F-del Casp9.IRES.GFP was a gift from David Spencer (Addgene plasmid # 15567 ; ; RRID:Addgene_15567)
  • For your References section:

    An inducible caspase 9 safety switch for T-cell therapy. Straathof KC, Pule MA, Yotnda P, Dotti G, Vanin EF, Brenner MK, Heslop HE, Spencer DM, Rooney CM. Blood. 2005 Jun 1. 105(11):4247-54. 10.1182/blood-2004-11-4564 PubMed 15728125