Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Fv-hCaspase 8-2A-GFP
(Plasmid #82712)


Item Catalog # Description Quantity Price (USD)
Plasmid 82712 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 7116
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
    Fv-Caspase 8-2A-GFP
  • Alt name
    dimerizale caspase 8
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    deleted amino acids 1-215 of caspase 8
  • GenBank ID
  • Entrez Gene
    CASP8 (a.k.a. ALPS2B, CAP4, Casp-8, FLICE, MACH, MCH5)
  • Promoter LTR
  • Tag / Fusion Protein
    • FKBP dimerization domain (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer ctttatccagccctcac
  • 3′ sequencing primer accctaactgacacacattcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Fv-hCaspase 8-2A-GFP was a gift from Douglas Green (Addgene plasmid # 82712 ; ; RRID:Addgene_82712)
  • For your References section:

    Inducible dimerization and inducible cleavage reveal a requirement for both processes in caspase-8 activation. Oberst A, Pop C, Tremblay AG, Blais V, Denault JB, Salvesen GS, Green DR. J Biol Chem. 2010 May 28;285(22):16632-42. doi: 10.1074/jbc.M109.095083. Epub 2010 Mar 22. 10.1074/jbc.M109.095083 PubMed 20308068