Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSH1/M-Fv-Casp3-E
(Plasmid #15271)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 15271 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSH1
  • Backbone manufacturer
    GR Crabtree lab
  • Backbone size w/o insert (bp) 3500
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FKBP12(V36)-Caspase3
  • Alt name
    yama, iCaspase-3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1240
  • Mutation
    FKBP12(V36) F36->V
  • Entrez Gene
    CASP3 (a.k.a. CPP32, CPP32B, SCA-1)
  • Tags / Fusion Proteins
    • HA epitope (C terminal on insert)
    • Myristoylation-targeting domain c-Src (14aa) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI, SacII (not destroyed)
  • 3′ cloning site EcoRI, BamHI (not destroyed)
  • 5′ sequencing primer gaggtgttacttctgctctaaaagc
  • 3′ sequencing primer cactgcattctagttgtggtttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSH1/M-Fv-Casp3-E was a gift from David Spencer (Addgene plasmid # 15271 ; http://n2t.net/addgene:15271 ; RRID:Addgene_15271)
  • For your References section:

    Improved artificial death switches based on caspases and FADD. Fan L, Freeman KW, Khan T, Pham E, Spencer DM. Hum Gene Ther. 1999 Sep 20. 10(14):2273-85. 10.1089/10430349950016924 PubMed 10515447