-
PurposeFluorescent protein fused to mRNA decapping enzyme 1a
-
Depositing Lab
-
Depositing OrganizationUniversity of Colorado, Boulder
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 153972 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 153972-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 153972-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepACGFP-c1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 6453
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemRNA decapping enzyme 1a
-
Alt nameDcp1a
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1746
-
Entrez GeneDCP1A (a.k.a. HSA275986, Nbla00360, SMAD4IP1, SMIF)
-
Tag
/ Fusion Protein
- pAcGFP-C1 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CCACTACCTGTCCACCCAGAGC
- 3′ sequencing primer GGTGTGGGAGGTTTTTTAAAGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 153972-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 153972-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-Dcp1a was a gift from Gia Voeltz (Addgene plasmid # 153972 ; http://n2t.net/addgene:153972 ; RRID:Addgene_153972) -
For your References section:
Endoplasmic reticulum contact sites regulate the dynamics of membraneless organelles. Lee JE, Cathey PI, Wu H, Parker R, Voeltz GK. Science. 2020 Jan 31;367(6477). pii: 367/6477/eaay7108. doi: 10.1126/science.aay7108. 10.1126/science.aay7108 PubMed 32001628