EC71174
(Plasmid
#154067)
-
PurposeLevel 2 Golden Gate vector, pL2M-HvHSP17-CREU5-UBQ-loxmCHERRYER-eGFPER
-
Depositing Lab
-
Depositing OrganizationJohn Innes Centre
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154067 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneEC15027
-
Backbone manufacturerENSA
- Backbone size w/o insert (bp) 4834
- Total vector size (bp) 13415
-
Vector typeBacterial Expression, Plant Expression, Cre/Lox, Synthetic Biology ; Golden Gate
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameHS Cre recombinase
-
Alt nameHS::CRE
-
SpeciesA. thaliana (mustard weed), Synthetic; Enterobacteria Phage P1, Hordeum vulgare heat shock promoter from pHSPdGUS (Freeman et al 2011, Plant Biotech Journal)
-
Insert Size (bp)2134
-
MutationThe Arabidopsis thaliana U5 small nuclear ribonucleoprotein component intron from pICSL80006 (TSL SynBio) is inserted at 254bp in the Cre recombinase. BsaI, Esp3I and BpiI restriction sites were removed using synonymous changes.
-
GenBank IDNM_2777477
- Promoter Hordeum vulgare HSP 17 promoter used in Freeman et al 2011 Plant Biotechnology Journal pHSPdGUS
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer GATGGTGCATGGACCACCCGGA
- 3′ sequencing primer ACCAGAGTGTCGTGCTCCACCA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameUbiquitin promoter driving mCherry with the 35S terminator, flanked by lox sites, followed by eGFP with the Actin terminator
-
Alt nameZmUbi::lox-mCHERRY-T35S-lox-eGFP-TAct
-
SpeciesA. thaliana (mustard weed), Synthetic; Hordeum vulgare (heat shock promoter), Zea mays (Ubiquitin promoter)
-
Insert Size (bp)4414
- Promoter Zea mays Ubiquitin promoter with intron
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer GCACATACAAATGGACGAAC
- 3′ sequencing primer ACCCAGAGAGTTTGTCACACACA
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameHYGROMYCIN Resistance Cassette
-
Alt nameHYG
-
Alt nameHPT
-
Alt name35S promoter driving HYG resistance gene with the NOS terminator
-
SpeciesSynthetic
-
Insert Size (bp)1909
- Promoter 35S promoter
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer TAACATAGATGACACCGCGCGCG
- 3′ sequencing primer TGGTGGAGCACGACACTCTGGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EC71174 was a gift from Cristobal Uauy (Addgene plasmid # 154067 ; http://n2t.net/addgene:154067 ; RRID:Addgene_154067) -
For your References section:
A heat-shock inducible system for flexible gene expression in cereals. Harrington SA, Backhaus AE, Fox S, Rogers C, Borrill P, Uauy C, Richardson A. Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020. 10.1186/s13007-020-00677-3 PubMed 33072173