pCS2+-Y276H PHYB-CAAX
(Plasmid
#154911)
-
Purpose1-621 amino acids of Arabidopsis PHYB (as in construct Addgene ID 154910) with the CAAX membrane moiety tag. Tyrosine residue 276 of PHYB was mutated to Histidine.
-
Depositing Labs
-
Depositing OrganizationKing's College London
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154911 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCS2+
-
Backbone manufacturerRZPD
- Backbone size w/o insert (bp) 4095
- Total vector size (bp) 6074
-
Vector typeMammalian Expression ; xenopus/avian/zebrafish
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePhytochrome B
-
Alt namePHYB
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)2676
-
Mutation1-621 amino acids of Arabidopsis PHYB, Tyrosine residue 276 of PHYB was mutated to Histidine
-
GenBank ID816394
-
Entrez GenePHYB (a.k.a. AT2G18790, HY3, MSF3.17, MSF3_17, OOP1, OUT OF PHASE 1, PHYTOCHROME B, phytochrome B)
- Promoter CMV
-
Tags
/ Fusion Proteins
- mCherry (C terminal on insert)
- CAAX membrane moiety (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer SP6 Forward ATTTAGGTGACACTATAG
- 3′ sequencing primer M13 Reverse GGAAACAGCTATGACCATG, T3 Forward AATTAACCCTCACTAAAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2+-Y276H PHYB-CAAX was a gift from Clare Buckley & Jonathan Clarke (Addgene plasmid # 154911 ; http://n2t.net/addgene:154911 ; RRID:Addgene_154911) -
For your References section:
Reversible Optogenetic Control of Subcellular Protein Localization in a Live Vertebrate Embryo. Buckley CE, Moore RE, Reade A, Goldberg AR, Weiner OD, Clarke JD. Dev Cell. 2016 Jan 11;36(1):117-26. doi: 10.1016/j.devcel.2015.12.011. 10.1016/j.devcel.2015.12.011 PubMed 26766447