pD649-HAsp-SEMA3E-COMP5AP-AviTag-9xHis
(Plasmid
#157534)
-
PurposeMammalian expression of secreted protein fused to COMP5AP-AviTag-9xHis.
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157534 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 157534-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 157534-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepD649
- Backbone size w/o insert (bp) 7153
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSEMA3E
-
Alt nameSEM3E
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2250
-
Entrez GeneSEMA3E (a.k.a. M-SEMAH, M-SemaK, SEMAH, coll-5)
- Promoter CMV/SP6
-
Tag
/ Fusion Protein
- COMP5AP-AviTag-9xHis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site GCGGCCGC (not destroyed)
- 3′ cloning site GGCGCGCC (not destroyed)
- 5′ sequencing primer ATTTAGGTGACACTATAG
- 3′ sequencing primer CGTCGCACTCCATCACGGTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bysynthesis by ThermoFisher
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Some plasmids in this collection may have an IS4-like element ISVsa5 family transposase upstream of the CMV promoter.
DNA (Catalog # 157534-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 157534-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pD649-HAsp-SEMA3E-COMP5AP-AviTag-9xHis was a gift from Chris Garcia (Addgene plasmid # 157534 ; http://n2t.net/addgene:157534 ; RRID:Addgene_157534) -
For your References section:
A Human IgSF Cell-Surface Interactome Reveals a Complex Network of Protein-Protein Interactions. Wojtowicz WM, Vielmetter J, Fernandes RA, Siepe DH, Eastman CL, Chisholm GB, Cox S, Klock H, Anderson PW, Rue SM, Miller JJ, Glaser SM, Bragstad ML, Vance J, Lam AW, Lesley SA, Zinn K, Garcia KC. Cell. 2020 Aug 20;182(4):1027-1043.e17. doi: 10.1016/j.cell.2020.07.025. 10.1016/j.cell.2020.07.025 PubMed 32822567