61427-sgHtt_10
(Plasmid
#157861)
-
PurposeExpresses a sgRNA targeting mouse Htt promoter for gene activation using the SAM system
-
Depositing Lab
-
Depositing OrganizationUniversity of Wisconsin, Madison
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157861 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAddgene #61427
- Backbone size w/o insert (bp) 9996
- Total vector size (bp) 9997
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHtt
-
gRNA/shRNA sequenceggtgtagggtggctttacgc
-
SpeciesM. musculus (mouse)
-
Entrez GeneHtt (a.k.a. C430023I11Rik, Hd, Hdh, IT15)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
61427-sgHtt_10 was a gift from Xinyu Zhao (Addgene plasmid # 157861 ; http://n2t.net/addgene:157861 ; RRID:Addgene_157861) -
For your References section:
Reduced mitochondrial fusion and Huntingtin levels contribute to impaired dendritic maturation and behavioral deficits in Fmr1-mutant mice. Shen M, Wang F, Li M, Sah N, Stockton ME, Tidei JJ, Gao Y, Korabelnikov T, Kannan S, Vevea JD, Chapman ER, Bhattacharyya A, van Praag H, Zhao X. Nat Neurosci. 2019 Mar;22(3):386-400. doi: 10.1038/s41593-019-0338-y. Epub 2019 Feb 11. 10.1038/s41593-019-0338-y PubMed 30742117