Skip to main content

pPK-351
(Plasmid #157921)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157921 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 157921-D50 50 μg of DNA in Tris buffer $495
DNA 157921-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression, Synthetic Biology ; Optogenetics

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH10B
  • Growth instructions
    This plasmid can grow slowly and have low yields but is more stable than pPK-230.
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PIF3-MTAD
  • Species
    H. sapiens (human), A. thaliana (mustard weed)
  • Insert Size (bp)
    701
  • Mutation
    pif3 1-523
  • Promoter CMV
  • Tag / Fusion Protein
    • SV40NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    IRES
  • Alt name
    Internal Ribosomal Entry Site
  • Insert Size (bp)
    583

Gene/Insert 3

  • Gene/Insert name
    PhyB(1-621)-SV40NLS-Gal4DBD
  • Species
    S. cerevisiae (budding yeast), A. thaliana (mustard weed)
  • Insert Size (bp)
    2391
  • Tag / Fusion Protein
    • HA tag (C terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer GACGTGGTTTTCCTTTGAAAAACAC
  • 3′ sequencing primer SP6 promoter
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPK-351 was a gift from Phillip Kyriakakis (Addgene plasmid # 157921 ; http://n2t.net/addgene:157921 ; RRID:Addgene_157921)
  • For your References section:

    Building a Simple and Versatile Illumination System for Optogenetic Experiments. Kyriakakis P, Fernandez de Cossio L, Howard PW, Kouv S, Catanho M, Hu VJ, Kyriakakis R, Allen ME, Ma Y, Aguilar-Rivera M, Coleman TP. J Vis Exp. 2021 Jan 12;(167). doi: 10.3791/61914. 10.3791/61914 PubMed 33522514