Skip to main content

pDONOR223 R2pH-LAMP1-3xFLAG
(Plasmid #157941)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 157941 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 157941-D50 50 μg of DNA in Tris buffer $495
DNA 157941-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pDONOR223
  • Vector type
    GATEWAY system

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    R2pH-LAMP1-3xFLAG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2745
  • GenBank ID
    NM_001317353.1:229-1452
  • Entrez Gene
    Lamp1 (a.k.a. CD107a, LGP-120, LGP-A, Lamp-1, P2B, Perk)
  • Tags / Fusion Proteins
    • mCherry
    • pHluorin
    • 3XFLAG (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCGCGTTAACGCTAGCATGGAT
  • 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDONOR223 R2pH-LAMP1-3xFLAG was a gift from Massimiliano Stagi (Addgene plasmid # 157941 ; http://n2t.net/addgene:157941 ; RRID:Addgene_157941)
  • For your References section:

    Live imaging of intra-lysosome pH in cell lines and primary neuronal culture using a novel genetically encoded biosensor. Ponsford AH, Ryan TA, Raimondi A, Cocucci E, Wycislo SA, Frohlich F, Swan LE, Stagi M. Autophagy. 2020 Jun 9:1-19. doi: 10.1080/15548627.2020.1771858. 10.1080/15548627.2020.1771858 PubMed 32515674