pEMS2260
(Plasmid
#158423)
-
PurposeAAV plasmid with Ple331 (PAX6 MiniPromoter) driving expression of EmGFP. Contains WPRE.
-
Depositing Lab
-
Depositing OrganizationUniversity of British Columbia
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepEMS2131
-
Backbone manufacturerElizabeth Simpson (Addgene plasmid # 111895)
- Backbone size w/o insert (bp) 4999
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)SURE cells
-
Growth instructions“SURE” cells from Agilent, that the colonies are freshly picked, and the you limit the time to grow the culture. We typically transform the plasmid in the afternoon and take out the plate from the 37 degree incubator in the morning, we then pick the colonies and grow in LB for ~ 20 hrs
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePle331
-
Alt namePAX6 MiniPromoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1981
-
GenBank IDPAX6 Gene
-
Entrez GenePAX6 (a.k.a. AN, AN1, AN2, ASGD5, D11S812E, FVH1, MGDA, WAGR)
- Promoter Ple331
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site FseI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer oEMS6098 (GCCATGCTCTAGGAAGATCG)
- 3′ sequencing primer oEMS6114 (CATCTTTTATGCTGCCAACC)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDNA synthesized at GenScript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see the annotated GenBank file and the additional image file for the specific location of features in this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEMS2260 was a gift from Elizabeth Simpson (Addgene plasmid # 158423 ; http://n2t.net/addgene:158423 ; RRID:Addgene_158423) -
For your References section:
Human MiniPromoters for ocular-rAAV expression in ON bipolar, cone, corneal, endothelial, Muller glial, and PAX6 cells. Korecki AJ, Cueva-Vargas JL, Fornes O, Agostinone J, Farkas RA, Hickmott JW, Lam SL, Mathelier A, Zhou M, Wasserman WW, Di Polo A, Simpson EM. Gene Ther. 2021 Feb 2. pii: 10.1038/s41434-021-00227-z. doi: 10.1038/s41434-021-00227-z. 10.1038/s41434-021-00227-z PubMed 33531684