CMV-mito-CitronRH
(Plasmid
#158547)
-
PurposeMitochondria-targeted nonbinding variant of direct-response citrate sensor
-
Depositing Lab
-
Depositing OrganizationUniversity of Alberta
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 158547-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 158547-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 6600
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCitronRH
-
Insert Size (bp)1100
- Promoter cmv
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains an A2V mutation in CitronRH. This mutation is not known to affect plasmid function.
DNA (Catalog # 158547-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 158547-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-mito-CitronRH was a gift from Robert Campbell (Addgene plasmid # 158547 ; http://n2t.net/addgene:158547 ; RRID:Addgene_158547) -
For your References section:
High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors for Citrate. Zhao Y, Shen Y, Wen Y, Campbell RE. ACS Cent Sci. 2020 Aug 26;6(8):1441-1450. doi: 10.1021/acscentsci.0c00518. Epub 2020 Jul 9. 10.1021/acscentsci.0c00518 PubMed 32875085