pKL11-GCaMP6f bb100
(Plasmid
#158983)
-
PurposeConstitutive expression (sigma 70 promoter) of GCaMP6f fluorophore in E. coli.
-
Depositing Lab
-
Depositing OrganizationUniversity of Colorado, Boulder
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 158983 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonebb118
- Backbone size w/o insert (bp) 2300
- Total vector size (bp) 3650
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6f
-
SpeciesSynthetic
-
Insert Size (bp)700
-
Mutationcodon optimized for e. coli from Addgene#100833
- Promoter Bba_J23100 (sigma 70)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer gctcactcaaaggcggtaat
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhttps://www.nature.com/articles/nature12354
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GCaMP6f was engineered in the paper above, then codon optimized for E. coli on a G-block and cloned into our bb100 backbone to facilitate constitutive expression . Please visit https://doi.org/10.1101/2020.04.23.058362 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKL11-GCaMP6f bb100 was a gift from Joel Kralj (Addgene plasmid # 158983 ; http://n2t.net/addgene:158983 ; RRID:Addgene_158983) -
For your References section:
Membrane voltage dysregulation driven by metabolic dysfunction underlies bactericidal activity of aminoglycosides. Bruni GN, Kralj JM. eLife. 2020 Aug 4;9. pii: 58706. doi: 10.7554/eLife.58706. 10.7554/eLife.58706 PubMed 32748785