pKL003
(Plasmid #98919)

• Purpose: Constitutively expresses the voltage indicator PROPS under the Sigma 70 promoter in E. coli.
• Depositing Lab: Joel Kralj
• Publication: Bruni et al Proc Natl Acad Sci U S A. 2017 Aug 29;114(35):9445-9450. doi: 10.1073/pnas.1703084114. Epub 2017 Aug 14.

Backbone

• Vector backbone: BB118
• Backbone manufacturer: Bio Bricks - iGem parts combined by Ben Dodd
• Backbone size w/o insert (bp): 2384
• Total vector size (bp): 3155
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: ColE1 origin; Depositor recommends BW25113 for expression
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PROPS
• Alt name: Proteorhodopsin Optical Proton Sensor
• Species: Synthetic
• Insert Size (bp): 771
• Promoter: BBa_J23118 - Strong Constitutive
• Tag / Fusion Protein:
  • His (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgccacctgacgtctaagaa
• 3′ sequencing primer: attaccgcctttgagtgagc

Resource Information

• Supplemental Documents:
  • BBa_J23118 PROPS example.gb
  • BBa_J23118 PROPS.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry