Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKL001
(Plasmid #98917)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 98917 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    BB118
  • Backbone manufacturer
    Bio Bricks - iGem parts combined by Ben Dodd
  • Backbone size w/o insert (bp) 2384
  • Total vector size (bp) 4487
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    ColE1 origin; Depositor recommends BW25113 for expression
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CaPR
  • Alt name
    PROPS fused to GCaMP6f
  • Species
    Synthetic
  • Insert Size (bp)
    2103
  • Promoter BBa_J23118 - Strong Constitutive

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKL001 was a gift from Joel Kralj (Addgene plasmid # 98917 ; http://n2t.net/addgene:98917 ; RRID:Addgene_98917)
  • For your References section:

    Voltage-gated calcium flux mediates Escherichia coli mechanosensation. Bruni GN, Weekley RA, Dodd BJT, Kralj JM. Proc Natl Acad Sci U S A. 2017 Aug 29;114(35):9445-9450. doi: 10.1073/pnas.1703084114. Epub 2017 Aug 14. 10.1073/pnas.1703084114 PubMed 28808010