-
PurposeExpresses the SARS-CoV-2 nsp13 protein with an N-terminal His6 tag followed by an HRV 3C/PreScission cleavage site.
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159390 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5297
- Total vector size (bp) 7108
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameN-terminal His tag PreScission SARS-CoV-2 nsp13, optimized for insect cell expression
-
SpeciesSARS-CoV-2
-
Insert Size (bp)1812
-
GenBank IDMT121215.1
- Promoter T7
-
Tag
/ Fusion Protein
- His6 tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byGenScript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Protein sequence was optimized by GenScript for insect cell expression using the OptimumGene Codon Optimization Analysis.
Please visit https://doi.org/10.1101/2020.07.08.194084 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a 6xHis PreScission SARS-CoV-2 nsp13 was a gift from Tarun Kapoor (Addgene plasmid # 159390 ; http://n2t.net/addgene:159390 ; RRID:Addgene_159390) -
For your References section:
Structural Basis for Helicase-Polymerase Coupling in the SARS-CoV-2 Replication-Transcription Complex. Chen J, Malone B, Llewellyn E, Grasso M, Shelton PMM, Olinares PDB, Maruthi K, Eng ET, Vatandaslar H, Chait BT, Kapoor TM, Darst SA, Campbell EA. Cell. 2020 Sep 17;182(6):1560-1573.e13. doi: 10.1016/j.cell.2020.07.033. Epub 2020 Jul 28. 10.1016/j.cell.2020.07.033 PubMed 32783916