pET28a 6xHis PreScission SARS-CoV-2 nsp13
(Plasmid #159390)

• Purpose: Expresses the SARS-CoV-2 nsp13 protein with an N-terminal His6 tag followed by an HRV 3C/PreScission cleavage site.
• Depositing Lab: Tarun Kapoor
• Publication: Chen et al bioRxiv. 2020 Jul 13. doi: 10.1101/2020.07.08.194084.

Backbone

• Vector backbone: pET28a
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5297
• Total vector size (bp): 7108
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: N-terminal His tag PreScission SARS-CoV-2 nsp13, optimized for insect cell expression
• Species: SARS-CoV-2
• Insert Size (bp): 1812
• GenBank ID: MT121215.1
• Promoter: T7
• Tag / Fusion Protein:
  • His6 tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: GenScript
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Protein sequence was optimized by GenScript for insect cell expression using the OptimumGene Codon Optimization Analysis.