pEF6-Lck-TurboID
(Plasmid
#159433)
-
Purposeexpresses Lck-TurboID in mammalian cells
-
Depositing Lab
-
Depositing OrganizationBrown University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 159433 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 159433-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 159433-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEF6
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5818
- Total vector size (bp) 8249
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameLck
-
Alt nameLck tyrosine kinase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1527
-
GenBank IDNM_001042771.2
-
Entrez GeneLCK (a.k.a. IMD22, LSK, YT16, p56lck, pp58lck)
- Promoter EF-1a
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site BbvCI (unknown if destroyed)
- 5′ sequencing primer TATATGAATTCGCCATGGGCTGTGGCTGC
- 3′ sequencing primer ATATGTTTAAACTCAAGCGTAATCTGGAACATCGTATGGGTAAGGCTGAGGCTGGTACTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTurboID (BirA mutant)
-
SpeciesE. coli
-
Insert Size (bp)969
-
MutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V160A, T192A, K194I, M209V, M241T, S263P, I305V
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BbvCI (unknown if destroyed)
- 3′ cloning site PmeI (unknown if destroyed)
- 5′ sequencing primer ATATGTTTAAACTCAAGCGTAATCTGGAACATCGTATGGGTAAGGCTGAGGCTGGTACTG
- 3′ sequencing primer TATATGTTTAAACTTAAGCGTAATCTGGAACATCGTATGGGTATCCGTCCAGGGTCAGGCGCTCC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTurboID obtained from Addgene #107169 (Alice Ting Lab)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 159433-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 159433-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF6-Lck-TurboID was a gift from Arthur Salomon (Addgene plasmid # 159433 ; http://n2t.net/addgene:159433 ; RRID:Addgene_159433) -
For your References section:
Quantitative Interactomics of Lck-TurboID in Living Human T Cells Unveils T Cell Receptor Stimulation-Induced Proximal Lck Interactors. Chua XY, Aballo T, Elnemer W, Tran M, Salomon A. J Proteome Res. 2020 Nov 13. doi: 10.1021/acs.jproteome.0c00616. 10.1021/acs.jproteome.0c00616 PubMed 33185455